Flpo antibody
WebCre-dependent mouse codon-optimized Flp recombinase. Alt name DIO-FLPo Species M. musculus (mouse), S. cerevisiae (budding yeast), Synthetic Insert Size (bp) 1299 … WebJan 20, 2015 · Transgene expression profiles, anti-transgene antibody titers, and bone healing after implantation of BV- engineered pASCs into mini pigs. (A) Expression duration of bone morphogenetic protein 2 ...
Flpo antibody
Did you know?
WebAAV pEF1a-DIO-FLPo-WPRE-hGHpA. Catalog No. PVT10893 Packing 2ug Function Mammal Editing plasmids Resistance Amp Screen / Strain Stbl3 Culture temperature 37degrees centigrade Replicon Copy ... CPE Antibody. $325.00. Write Review . Add to Cart. Add to Wishlist; Add to Compare; Write Review . Quick View. New. Human OLFM2 … WebFlp-mediated excision of the transcriptional “Stop” leading to TGFβCA expression is represented. Primers used for DNA genotyping (panel c), RT-PCR (panel d, e and Fig. 5b–d) are represented by grey... We would like to show you a description here but the site won’t allow us.
WebFLPo is a mouse codon-optimized FLP. How to cite this plasmid ( Back to top ) These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were … WebNov 21, 2016 · The dual expression vector was used for the fluorescence lifetime imaging (FLIM) screen, the ratiometric screen (RFP brightness and green component), the photostability assay using widefield...
WebFlp recombinase is used as a tool for the generation of transgenic animals. Limitations This product is for research use only and is not approved for use in humans or in clinical …
WebFeb 21, 2024 · a Schematic of the intersectional, anterograde transsynaptic targeting of neurons that receive monosynaptic inputs from two upstream brain regions. b EYFP fluorescence in 293T cells transfected...
Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg eastchester irish paradeWebFlp polyclonal antibody Cat. No. C15310169 Type: Polyclonal Specificity: Size: 100 µl Isotype: NA Concentration: not determined Host: Rabbit Lot No.: A280-004 Purity: Whole … cube coffee table woodWebFlp recombinase Use Cre/Lox, Lentiviral, and RNAi Tags Expression Mammalian Mutation Promoter Availability Academic Institutions and Nonprofits only Enlarge pCAG-FlpO Plasmid #89574 Purpose Expresses FlpO under pCAG Depositor Wilson Wong Article Weinberg et al Nat Biotechnol. 2024 Mar 27. doi: 10.103 Insert FlpO Use Cre/Lox and Synthetic Biology cube coffee table with storageWebThis antibody reacts with a membrane-bound isoenzyme of placental alkaline phosphatase (PLAP) occurring in the placenta during the 3rd trimester of gestation. It is useful in the identification of testicular germ cell tumors. Unlike germ cell tumors, PLAP-positive somatic cell tumors uniformly express epithelial membrane antigen (EMA). cube collection sinkWebSee our retrograde AAV based on the functional catagories listed below. Narrow down the items available within a category by using the buttons. Controls Green Red Switch Other Recombinases Cre Flp VCre Dre Calcium Sensors GCaMP8f GCaMP8s GCaMP8m GCaMP7f GCaMP7s GCaMP7b GCaMP6f GCaMP6s GECO Other Biosensors … eastchester italian american clubWebJul 21, 2016 · For the stop codon knock-in mouse line (hereon known as DBH-p2a-FLPo) targeting vector, the 5’ homology arm is a 1kb fragment going from -1000 to 0 relative to the stop codon of the gene and the 3’ homology arm is a 1kb fragment extending +4 to +1003 (deleting the PAM motif of the sgRNA). eastchester italian restaurantWebThe ABBV-8E12 antibody has been selected through a screening of antibodies able to block seeding activity from brain extracts of P301S tau-transgenic mice using a FRET … cube collection trough sink